View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5264_low_18 (Length: 204)
Name: NF5264_low_18
Description: NF5264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5264_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 24 - 186
Target Start/End: Original strand, 2512021 - 2512183
Alignment:
| Q |
24 |
atgcaaagtagtaataaataatttgaaagtattgcatatagtattaattaaagttacaattnnnnnnnnnntcacttaaaactacatattgggaaatgaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
2512021 |
atgcaaagtagtaataaataatttgaaagtattgcatatagtattaattagagttacaattgaaaaaaaa-tcacttaaaactacacattgggaaatgaa |
2512119 |
T |
 |
| Q |
124 |
agtgagacac-ctttgggataaatattatgcaagtgctaacatgtgtctttaagagcacatgtt |
186 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2512120 |
agtgagacactctttgggataaatattatgcaagtgctaacatgtgtctttaagagcacatgtt |
2512183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University