View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_14 (Length: 430)
Name: NF5265_high_14
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 67 - 280
Target Start/End: Complemental strand, 36726691 - 36726478
Alignment:
| Q |
67 |
ggattttctactttgctttggtgaaaatacatgtttgggaaattccttgcatgctgagttgtctggagccatgagagcaatagagattgcaaactcacat |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36726691 |
ggattttctactttgctttggtgaaaatacaggtttgggaaactccttgcatgtcgagttgtctggagccatgagaccaatagagattgcaaactcacat |
36726592 |
T |
 |
| Q |
167 |
caatggtcgaatttatggctggaagtagattcaaaattggtgatcaaagccttcaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
266 |
Q |
| |
|
|| ||||||| ||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726591 |
cagcggtcgaaattatggctggaagcagattcagaattggtgatcaaagccttaaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
36726492 |
T |
 |
| Q |
267 |
actgcgttcaattg |
280 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36726491 |
actgcgttcaattg |
36726478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 133; Significance: 5e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 290 - 430
Target Start/End: Complemental strand, 25276704 - 25276564
Alignment:
| Q |
290 |
gccttctggccactactcactactgagttggcaacttggaaaaacaaagtaaatgccaacataagacaatggttctccaattgcactcgtacgaagcttt |
389 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25276704 |
gccttctggctactactcactactgagttggcaacttggaaaaacaaagtaaatgccaacataagacaatggttctccaattgcactcgtacgaagcttt |
25276605 |
T |
 |
| Q |
390 |
tactccatcaagtcacacatcacaaatacccatatagagaa |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25276604 |
tactccatcaagtcacacatcacaaatacccttatagagaa |
25276564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 38 - 93
Target Start/End: Original strand, 23881443 - 23881498
Alignment:
| Q |
38 |
tgtggaggaattttcagagatagtaaatcggattttctactttgctttggtgaaaa |
93 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||||||| | ||||||||||| ||||| |
|
|
| T |
23881443 |
tgtgggggaatcttcagagatagtaattcggattttttgctttgctttggagaaaa |
23881498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University