View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_19 (Length: 397)
Name: NF5265_high_19
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 22 - 391
Target Start/End: Complemental strand, 17889864 - 17889495
Alignment:
| Q |
22 |
aaggtaccaaacactttctgatcactctcttgtcacccttggtgacttatttcactacatgttagagctcaagtcgcggcttccccgtgaaacatgcatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17889864 |
aaggtaccaaacactttctgatcactctcttgtcacccttggtgacttatttcactacatgttagagctcaagtcgcggcttccccgtgaaacatgcatt |
17889765 |
T |
 |
| Q |
122 |
ggttccatcaacacaaacgccttagtcgaaacaaattgtcgttggtcccctaaaaggattgaaatggcaacacgggtcattgtcgaggccttaaaaagaa |
221 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17889764 |
ggttccttcaacacaagcgccttagtcgaaacaaattgtcgttggtcccctaaaaggattgaaatggcaacacgggtcattgtcgaggccttaaaaagaa |
17889665 |
T |
 |
| Q |
222 |
ctgaattcagatggatttcaagacaagaagtgagagatgccgcacgtgcttatattggagacactggtttgttggattttgttttgaagtcgctaggaaa |
321 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17889664 |
ctgaattcaggtggatttcaagacaagaagtgagagatgccgcgcgtgcttatattggagacactggtttgttggattttgttttgaagtcgctaggaaa |
17889565 |
T |
 |
| Q |
322 |
ccacgttgttggaaactatttggttcgtcgaagcttgaatccagttacaaaagtgttggagtattattta |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
17889564 |
ccacgttgttggaaactatttggttcgtcgaagcttgaatccggttacaaaagtgttggagtattgttta |
17889495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University