View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_28 (Length: 341)
Name: NF5265_high_28
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 2658119 - 2657793
Alignment:
| Q |
1 |
agcatagggtcgggaattatggccggtgcctcttcgggtttggcaagttgagcattgatatatgctatctcatctgagacattgtttggaactgacgcaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2658119 |
agcataaggtcgggaattatggccggtgcctcttcgggtttggcaagttgagcattgatatatgctatctcatctgagacattgtttggaactgacgcaa |
2658020 |
T |
 |
| Q |
101 |
caggtgaaggagcagggacgatttcatcttccctaacgacaatggttttctgaagcgagaaatggaaatggtgggatatatttattggattaacaagata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2658019 |
caggtgaaggagcagggacgatttcatcttccctaacgacaatggttttctgaagcgagaaatggaaatggtgggatatatttattggattaacaagata |
2657920 |
T |
 |
| Q |
201 |
tttcgtcaaaaagcttacttgtcattcataatcattcaaattaacatgtaaagtactccatcttattaaagttgataaggaataggagcgaaaatttccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2657919 |
tttcgtcaaaaagcttacttgtcattcataatcattcaaattaacatgtaaattactccatcttattaaagttgataaggaataggagcgaaaatttccc |
2657820 |
T |
 |
| Q |
301 |
tctcatataaggataaattgttgaatg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2657819 |
tctcatataaggataaattgttgaatg |
2657793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University