View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_30 (Length: 336)
Name: NF5265_high_30
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 14 - 326
Target Start/End: Complemental strand, 21446025 - 21445717
Alignment:
| Q |
14 |
ggtagtgatgaggatttcagtgacgacagtgacagacatgtagacgatgaggtagatttttggttttatgttggttaaattatttacctagatgaaatgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21446025 |
ggtagtgatgaggatttcagtgacgacagtgacagacatgtagacgatgaggtagatttttggttttatgttggttaaattgtttacctagatgaaatgt |
21445926 |
T |
 |
| Q |
114 |
ctgtatgtatgtatgcgatgaaatgtctgtatcgatgtgataaaacttgccggatagaagaatttcaacttccatctttgggtttcctttcctattcctc |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445925 |
ctgtatgtatg----cgatgaaatgtctgtatcgatgtgataaaacttgccggatagaagaatttcaacttccatctttgggtttcctttcctattcctc |
21445830 |
T |
 |
| Q |
214 |
ttgctagcaatggtaataggaattgacaattgacaatgttctcttttcccgtgacgttgggttatcaattgggaatgaatcgatgccaagctaagttttg |
313 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21445829 |
ttgctagcaatggtaataggaagtgacaattgacaatgttctcttttcccgtgacgttgggttatcaattgggaatgaattgatgccaagctaagttttg |
21445730 |
T |
 |
| Q |
314 |
agtagtacctatg |
326 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21445729 |
agtagtacctatg |
21445717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University