View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_35 (Length: 319)
Name: NF5265_high_35
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 43452999 - 43452845
Alignment:
| Q |
1 |
taccctcctaatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtataactggttctgcatcttcttgtgatatgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43452999 |
taccctcctaatattaatattttttgacatcattgtttttgttggtgtagctttttccttcaactgtgtaactggttctgcatcttcttgtgatatgcta |
43452900 |
T |
 |
| Q |
101 |
gtttgtttgtctgaagcagtattagactgctgaagtgtcttcatgtctttgttctcaa |
158 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43452899 |
gtttgtctgtctgaagcagtattaga---ctgaagtgtcttcatgtctttgttctcaa |
43452845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 243 - 309
Target Start/End: Complemental strand, 43452760 - 43452694
Alignment:
| Q |
243 |
gatatgaccattacaatgaccatggccaccaaaatgaaggttgaaaactttcatgttcacaggttct |
309 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
43452760 |
gatatgaccatgacaatgaccatggccaccaaaatgaagtttgaaaactttcatgttcataggttct |
43452694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University