View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_50 (Length: 267)
Name: NF5265_high_50
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 252
Target Start/End: Complemental strand, 39694879 - 39694643
Alignment:
| Q |
16 |
ctttcattgcttaagtatctagaacttctagtttctattagaaaaagcataactaacaaatgaaacaatcaagccaataaaagttggctggtctagatgg |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694879 |
ctttcattgcttaagtatctggaacttctagtttctattagaaaaagcataactaacaaatgaaacaatcaagccaataaaagttggctggtctagatgg |
39694780 |
T |
 |
| Q |
116 |
ttggatctttggctcctaccgacactaacttggatttaaattcgannnnnnnnctgttaccttctatgtctaatgtcaaggttggtagttctagcattgt |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39694779 |
ttggatctttggctcctaccgaccctaacttggatttaaattcgattttttttctgttaccttgtatgtctaatgtcaaggttggtagttctagcattgt |
39694680 |
T |
 |
| Q |
216 |
gcctctactcatctaaatttgtttagataaaaatggt |
252 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |
|
|
| T |
39694679 |
gcctctcctgatctaaatttgtttagataaaaatggt |
39694643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University