View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_53 (Length: 258)
Name: NF5265_high_53
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 148 - 247
Target Start/End: Original strand, 24506443 - 24506542
Alignment:
| Q |
148 |
gttggttgtgtgagttgaatgtaaattgtgcaggttttgaagcatgcgctaggaaggattaattttgtgttggcatcaagtgccttattcttctctgatg |
247 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24506443 |
gttgattgtgtgagttgaatgtaaattgtgcaggttttgaagcatgcgctaggaaggattaattttgtgttggcatcaagtgccttattcttctctgatg |
24506542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 24517949 - 24518013
Alignment:
| Q |
8 |
tttttggtatgttatgatgactggttgactaactcttcctcgcttacaagatcaagggagatgat |
72 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
24517949 |
tttttggtatattatgaaaattggttgactaactcttcctctgttacatgatcaaggtagatgat |
24518013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 205
Target Start/End: Original strand, 24518089 - 24518145
Alignment:
| Q |
149 |
ttggttgtgtgagttgaatgtaaattgtgcaggttttgaagcatgcgctaggaagga |
205 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||| ||||||||||| ||||| ||||| |
|
|
| T |
24518089 |
ttggttgtatgagttgaatgtaaattatgtagggtttgaagcatgtgctagaaagga |
24518145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 146 - 193
Target Start/End: Original strand, 35456163 - 35456210
Alignment:
| Q |
146 |
cagttggttgtgtgagttgaatgtaaattgtgcaggttttgaagcatg |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
35456163 |
cagttggttgtgtgaattgaatgtaaattgtgcaggttttgaatcatg |
35456210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 154 - 192
Target Start/End: Original strand, 29082248 - 29082286
Alignment:
| Q |
154 |
tgtgtgagttgaatgtaaattgtgcaggttttgaagcat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29082248 |
tgtgtgagttgaatgtaaattgtgcaggttttgaagcat |
29082286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 29082102 - 29082173
Alignment:
| Q |
1 |
ttgcaagtttttggtatgttatgatgactggttgactaactcttcctcgcttacaagatcaagggagatgat |
72 |
Q |
| |
|
|||||||||||||| || ||| || |||||||| |||||||||||||| ||||| | ||| |||||||||| |
|
|
| T |
29082102 |
ttgcaagtttttggaatcttaggaagactggtttactaactcttcctctgttacaggctcatgggagatgat |
29082173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University