View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_62 (Length: 250)
Name: NF5265_high_62
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 13975965 - 13975743
Alignment:
| Q |
12 |
tttaggttaattcatatgatcatcattggttaagtctttaaatggtacaccctttaatttcaactcaa-tatcaactttcaaacaagcaatagaacacta |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13975965 |
tttaggttaatccatatgatcatcattggttaagtctttaaatggtacaccctttaatttcaactcaaatatcaactttcaaacaagcaatagaacacta |
13975866 |
T |
|
| Q |
111 |
ttctatcctcttccctagattttattattaatcattgttactactcgccattgcatttttcttgtgttctagcattgaggatagtttttccatattccct |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
13975865 |
ttctatcctcttccctagattatattattaatcattgttactactcgccattgcatttttcttgtgttttagcattgaggatagtttttccatactccct |
13975766 |
T |
|
| Q |
211 |
aattgatttccgatggttagtat |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13975765 |
aattgatttccgatggttagtat |
13975743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University