View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_80 (Length: 228)
Name: NF5265_high_80
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 38776405 - 38776300
Alignment:
| Q |
4 |
tcagtggttgattggatgcatcactaaaccttcacaagttttatgcaacagaatttatacttccagaagccattcctctgttattgtctgtttaatacac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||| |
|
|
| T |
38776405 |
tcagtggttgattggatgcatcactaaaccttca--agttttatgcaacagaatttatactttcagaagccattcctctgttattgtctgttt-attcac |
38776309 |
T |
|
| Q |
104 |
aagcgattt |
112 |
Q |
| |
|
||||||||| |
|
|
| T |
38776308 |
aagcgattt |
38776300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 226
Target Start/End: Complemental strand, 38770634 - 38770530
Alignment:
| Q |
111 |
ttttaacatttgcttgatgtttacatttctagatatgtggcaatgtcaagaatgaagggtagcgctctgtataaagttgaccatctagaatattatgata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38770634 |
ttttaacatttgcttgatgtttacatttcttgatatgtggcaatgtc-agaatgaaggatagcgctc----------tgaccatctagaatattatgata |
38770546 |
T |
|
| Q |
211 |
atccactatttagttg |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38770545 |
atccactatttagttg |
38770530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University