View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_high_84 (Length: 218)
Name: NF5265_high_84
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_high_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 42200488 - 42200291
Alignment:
| Q |
1 |
tgtatggtgaataataataatacattctttttggtgtattctaaaa-------atgcattttatgatggaccattctaaattgtgttgtccattttgaag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42200488 |
tgtatggtgaataataataatacattctttttggtgtattctaaaattcaaatatgcattttatgatggaccattctaaattgtgttgtccattttgaag |
42200389 |
T |
 |
| Q |
94 |
gtagattgcgttgtgcagtccgtaaggaagcaaatatagaaagtaggttaattggaggtagatggcgtacatacaagtttgtatttttcatcttgatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42200388 |
gtagattgcgttgtgcagtccgtaaggaagcaaatatagaaagtaggtgaattggaggtcgatggcgtacatacaagtttgtatttttcatcttgatg |
42200291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University