View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_20 (Length: 390)
Name: NF5265_low_20
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 38186570 - 38186900
Alignment:
| Q |
18 |
gtgtggaggtgcgatttcggtagtgcaggcaggtcttttgcggtttccatttgattttaatggatgttttgcttggagaagctttttcttggttggtttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38186570 |
gtgtggaggtgcgatttcggtagtgcaggcaggtcttttgcggtttccatttgattttaatggatgttttgcttggagtagctttttcttggttggtttt |
38186669 |
T |
|
| Q |
118 |
gagttttattcctatcatttcctccttggtctgcgactgttgttttgataacaaagggactgttttgcgctac-----caggtttttggtgcattgnnnn |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
38186670 |
gagttttattcctagcatttcctccttggtctgcgactgttgttttgataacaaatggattgttttgcgctaccagcacaggtttttggtgcattgtttt |
38186769 |
T |
|
| Q |
213 |
nnnggttttgtttggcttcggcagcttggaggtgcttggcaatttttagtgaggcagaggtgtgcttcaggagtcagtgctgattaggcctggctgtgtg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186770 |
tttggttttgtttggcttcggcagcttggaggtgctcgacaatttttagtgaggcaggggtgtgcttcaggagtcagtgctgattaggcctggctgtgtg |
38186869 |
T |
|
| Q |
313 |
tatatgccgatctcactaattttggggatgg |
343 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
38186870 |
tatatgccgacctcactaattttggggatgg |
38186900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University