View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_24 (Length: 371)
Name: NF5265_low_24
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 31098312 - 31098671
Alignment:
| Q |
1 |
cacatgtcaacacccctttgcttttgaggagcttcacagccatctacttgctcatgatgactaccttcgtcattaaacacaaactgatatacaagttcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098312 |
cacatgtcaacacccctttgcttttgaggagcttcacagccatctacttgctcacgatgactaccttcgtcattaaacacaaactgatatacaagttcct |
31098411 |
T |
 |
| Q |
101 |
tttgcaaattttgcaatgctgcggcggcaaagacggtcttctcccaacaccatctcatggtcgtgacttcttcaataataagccatctcaaacaaacgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098412 |
tttgcaaattttgcaatgctgcggcggcaaagacggtcttctcccaacaccatctcatggtcgtgacttcttcaataataagccatctcaaacaaacgca |
31098511 |
T |
 |
| Q |
201 |
tctttctcttctcgcagtacatagctctcattttcttaaaactcgtggctttaccttgttgcaacagacctccatcaagatgcaaaaaatactccctcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
31098512 |
tctttctcttctcgcagtacatagctctcattttcttaaaactcgtggctttacctcgttgcaacagacctccatcaagatgcaaatattactccctcct |
31098611 |
T |
 |
| Q |
301 |
tggtcacaatctcccactgccttcgcaaccacctgctcatcctctctttggcatgttcat |
360 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31098612 |
tggtcacaatctcccactgcctttgcaaccacctgctcatcctctctttggcatgctcat |
31098671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 1700845 - 1700908
Alignment:
| Q |
8 |
caacacccctttgcttttgaggagcttcacagccatctacttgctcatgatgactaccttcgtc |
71 |
Q |
| |
|
|||||||| ||| | |||||||||||||| |||||||| || || |||||||||||||| |||| |
|
|
| T |
1700845 |
caacacccttttacctttgaggagcttcatagccatcttctcgcacatgatgactacctgcgtc |
1700908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University