View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_26 (Length: 351)
Name: NF5265_low_26
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 9 - 332
Target Start/End: Original strand, 41895464 - 41895787
Alignment:
| Q |
9 |
agcagagagagttgacgtgaccggaagtaaatggcataggatagggctatgcactctcacaattgtgtaggctatccctaccctccacagccacctgttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41895464 |
agcagagagagttgacgtgaccggaagtaaatggcataggatagggctatgcactctcacaattgtgtaggctatccctaccctccacagccacctgttg |
41895563 |
T |
|
| Q |
109 |
atgtgacccactctacattaacaaccagttaaaactgtaacatttcaagaacataaatcaccattttcaaatcaaattcacccaaattataaaccgttgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41895564 |
atgtgacccactctacattaacaaccagttaaaactgtaacatttcaagaacataaatcaccattttcaaatcaaattcacccaaattataaaccgttgg |
41895663 |
T |
|
| Q |
209 |
atttccatattgttgctcggtaaccaaagttttattaccannnnnnnnaattatttttacactgccagaagaacaatctcaatctgaatctgaatcatgg |
308 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41895664 |
atttccacattgttgctcggtaaccaaagttttgttaccattttttttaattatttttacactgccagaagaacaatctcaatctgaatctgaatcatgg |
41895763 |
T |
|
| Q |
309 |
tttgattatttttcatggccggaa |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41895764 |
tttgattatttttcatggccggaa |
41895787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University