View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_33 (Length: 322)
Name: NF5265_low_33
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 55572297 - 55572132
Alignment:
| Q |
1 |
ctcgcactacaaacacatctataagcgtcnnnnnnnnnnnattaataattttatggactaaactagctaaacgactacacattcgaggatcataatgact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572297 |
ctcgcactacaaacacatctataagcgtctttttttt---attaataattttatggaccaaactagctaaacgactacacattcgaggatcataatgact |
55572201 |
T |
 |
| Q |
101 |
tttttcaattttgattcattcaaaaactatcgtggcaatgtctcacacatttaaggattactgtttatt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572200 |
tttttcaattttgattcattcaaaaactatcgtggcaatgtctcacacatttaaggattactgtttatt |
55572132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 229 - 311
Target Start/End: Complemental strand, 55572136 - 55572054
Alignment:
| Q |
229 |
ttattgtatttctttcattctgctgaaaaaatctctttggtgaggtactaacaggtacataaggagaggacatatatagtatt |
311 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55572136 |
ttattgtctttctttcattctgctgaaaaaatctctttggtgaggtactaacaggtacataaggtgaggacatatatagtatt |
55572054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University