View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_34 (Length: 319)
Name: NF5265_low_34
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 43 - 147
Target Start/End: Complemental strand, 4388788 - 4388684
Alignment:
| Q |
43 |
ttaaccccaccctttcatggcttggcttcatcccatgagaagtaacacactatttaatgctctctttgatcatcattttataaaataaagattaatcgat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
4388788 |
ttaaccccaccctttcatggcttggcttcatcccatgagaagtaacacactatttaatgctatctctgataatcattttataaaataaagattaatcgat |
4388689 |
T |
|
| Q |
143 |
aaaaa |
147 |
Q |
| |
|
||||| |
|
|
| T |
4388688 |
aaaaa |
4388684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 215 - 306
Target Start/End: Complemental strand, 4388616 - 4388525
Alignment:
| Q |
215 |
aaagaatcggagaaaattannnnnnncttataaaacactctttattgattnnnnnnnngaaaatgtatctttaatctatttaaattgcccct |
306 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4388616 |
aaagaatcggagaaaattataattttcttataaaacactctttattgattaaaaaaaagaaaatgtatctttaatctatttaaattgcccct |
4388525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University