View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_38 (Length: 311)
Name: NF5265_low_38
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 295
Target Start/End: Original strand, 9147266 - 9147546
Alignment:
| Q |
15 |
ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaannnnnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147266 |
ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaatttttatttt |
9147365 |
T |
 |
| Q |
115 |
nnnnnngttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147366 |
tattttgttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat |
9147465 |
T |
 |
| Q |
215 |
ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaacctta |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147466 |
ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaacctta |
9147546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University