View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5265_low_38 (Length: 311)

Name: NF5265_low_38
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5265_low_38
NF5265_low_38
[»] chr2 (1 HSPs)
chr2 (15-295)||(9147266-9147546)


Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 295
Target Start/End: Original strand, 9147266 - 9147546
Alignment:
15 ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaannnnnnnnnn 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              
9147266 ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaatttttatttt 9147365  T
115 nnnnnngttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat 214  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9147366 tattttgttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat 9147465  T
215 ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaacctta 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9147466 ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaacctta 9147546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University