View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_42 (Length: 299)
Name: NF5265_low_42
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 20 - 290
Target Start/End: Original strand, 29768232 - 29768502
Alignment:
| Q |
20 |
ggaccgactccggtcacaagcacccttctagctcccaagtcaaacaaccgctgcattacaatttacatatcacttagactctgttcggtaaattaattta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29768232 |
ggaccgactccggtcacaagcacccttctagctcccaagtcaaacaacctctgcattacaatttacatatcacttagactctgttcggtaaattaattta |
29768331 |
T |
 |
| Q |
120 |
taacggataatttaacaaattaaatttgaaagagagaatcaccataagaatatttcgatactgagagacaagataggtgcagtattgttgtggcacggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29768332 |
taacggataatttaacaaattaaatttgaaagagagaatcaccataagaatatttcgatactgagagacaagataggtgcagtattgttgtggcacggtg |
29768431 |
T |
 |
| Q |
220 |
aattgacgagacctagctgaaaatggagtgagaaaatagttgttgacaaaatcattaccaccaagtattat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29768432 |
aattgacgagacctagctgaaaatggagtgagaaaatagttgttgacaaaatcattaccaccaagtgttat |
29768502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 220 - 284
Target Start/End: Complemental strand, 48084499 - 48084435
Alignment:
| Q |
220 |
aattgacgagacctagctgaaaatggagtgagaaaatagttgttgacaaaatcattaccaccaag |
284 |
Q |
| |
|
||||||||||| || |||||||| ||| | | |||||||||||||||||||||| |||||||| |
|
|
| T |
48084499 |
aattgacgagatcttgctgaaaaaggaaccaaataatagttgttgacaaaatcattgccaccaag |
48084435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University