View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_44 (Length: 294)
Name: NF5265_low_44
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 42738786 - 42738523
Alignment:
| Q |
13 |
atgaatgttaacaatgaaactggaaaaaagaagaatgaaaaggaagagaagggtatataccgtattgtttcctccagtgttgaaaatatgggaacagagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738786 |
atgaatgttaacaatgaaactggaaaaaagaagaatgaaaaggaagagaagggtatataccgtattgtttcctccagtgttgaaaatatgggaacagagc |
42738687 |
T |
|
| Q |
113 |
tgcagagtaatcataagctagaaactgatcattatctttggaaatattgctagcttgcgatgtaattctctgcatatcaggtagattcccatgtagaaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738686 |
tgcagagtaatcataagctagaaactgatcattatctttggaaatattgctagcttgcgatgtaattctctgcatatcaggtagattcccatgtagaaaa |
42738587 |
T |
|
| Q |
213 |
gaagaaggtggaggccctctaataccttgcattctgagctttcttcttaccctttgggacttat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42738586 |
gaagaaggtggaggccctctaataccttgcattctgagctttcttcttaccctttgggaattat |
42738523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University