View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_46 (Length: 289)
Name: NF5265_low_46
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 13168007 - 13168218
Alignment:
| Q |
1 |
aaatgtataatttagtagattctcaaggttgtttatcaatgaaattgggtcaccaaaatataaaatgttcatttttatatactactaagcaacatcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168007 |
aaatgtataatttagtagattctcaaggttgtttatcaatgaaattgggtcaccaaaatataaaatgttcatttttatatactactaagcaacatcacaa |
13168106 |
T |
 |
| Q |
101 |
atatttgatgtcctgaaaaaagggaccttaggctatcccatggattattcttgcaaatggttgctattccaaatataaatttctcacacactcacaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168107 |
atatttgatgtcctgaaaaaagggaccttaggctatcccatggattattcttgcaaatggttgctattccaaatataaatttctcacacactcacaaaat |
13168206 |
T |
 |
| Q |
201 |
ctttattctacc |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
13168207 |
atttattctacc |
13168218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 12850478 - 12850540
Alignment:
| Q |
1 |
aaatgtataatttagtagattctcaaggttgtttatcaatgaaattgggtcaccaaaatataaa |
64 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
12850478 |
aaatttataatttagtggattctcaaggttgttcatcaaagaaatt-ggtcaccaaaatataaa |
12850540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University