View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_48 (Length: 280)
Name: NF5265_low_48
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 6 - 274
Target Start/End: Complemental strand, 31647184 - 31646916
Alignment:
| Q |
6 |
aggagcacagattccaatcccaatccaaccnnnnnnnnnttaacaacatgtgatgcaaagaagggtaggagcacaaattcatcatatattggaacaatca |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
31647184 |
aggagcacaaattccaatcccaatccaaccaaaaaa---ttaacaacatgtgatgcaaagaaaggtacgagcacaaattcatcataaattgaaacaatca |
31647088 |
T |
|
| Q |
106 |
ttatttttgcctttagttggtttagtttattgctggnnnnnnnn--cccttatgttatttc-tgtatgcagttgttgttgcttctgtatcaggtgctgtt |
202 |
Q |
| |
|
|| ||| ||||| |||||||||||||| ||||||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31647087 |
ttggtttagccttcagttggtttagtttgttgctggttttttttttcccttgtgttattttatgtatgtagttgttgttgcttctgtatcaggtgctgtt |
31646988 |
T |
|
| Q |
203 |
ttttggctgcttgctgttagggagtttatttcctgctgtggcgatgccctgttgtttttagttggttctttt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646987 |
ttttggctgcttgctgttagggagtttatttcctgttgtggcgatgccctgttgtttttagttggttctttt |
31646916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 45 - 274
Target Start/End: Original strand, 5961719 - 5961958
Alignment:
| Q |
45 |
ttaacaacatgtgatgcaaagaagggtaggagcacaaattcatcatatattggaacaatcattatttttgcctttagttggtttagtttattgctggnnn |
144 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||| | | |||||||||||||| ||||||| |
|
|
| T |
5961719 |
ttaacaacatgtgatgcagagaagggtaggagcacaaattcatcataaattggaacaatcattggtttag---tcagttggtttagtttgttgctgggtt |
5961815 |
T |
|
| Q |
145 |
nnnnncccttatgtta-tttctgtatgcagttgttgttgcttctgtatcaggtgctgttttttggctgctt--------gctgttagggagtttatttcc |
235 |
Q |
| |
|
||||| ||||| ||||||||||||| | ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5961816 |
tttttcccttctgttattttctgtatgcagctattgttgcttctgtattaggtgctgttttttggctgcttgttgtacggctgttagggagtttatttcc |
5961915 |
T |
|
| Q |
236 |
tgctgt----ggcgatgccctgttgtttttagttggttctttt |
274 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
5961916 |
tgctgtttggggcgctgccgtgttgtttttagttggttctttt |
5961958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 47 - 84
Target Start/End: Original strand, 22587830 - 22587867
Alignment:
| Q |
47 |
aacaacatgtgatgcaaagaagggtaggagcacaaatt |
84 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22587830 |
aacaacatgtgatgcagagaagggtaggagcacaaatt |
22587867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University