View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5265_low_59 (Length: 254)

Name: NF5265_low_59
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5265_low_59
NF5265_low_59
[»] chr4 (1 HSPs)
chr4 (3-254)||(21445148-21445387)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 254
Target Start/End: Original strand, 21445148 - 21445387
Alignment:
3 ttgaggaggagcagagaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat 102  Q
    |||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21445148 ttgaggagcaccagaaaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat 21445247  T
103 agtttcttctcactcttttcagcaagtaacgaaggataagcgcaaaagggttcttgagatgccactgctattggcaccgctattggcaccggctcacttc 202  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||    
21445248 agtttcttctcactcttttctgcaagtaacgaaggataagcgcaaaagggttcttgagatgccact------------gctattggcaccggctcacttc 21445335  T
203 tagttctaaggaattggtcgagattttggcggtatttaatcccatggatttt 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
21445336 tagttctaaggaattggtcgagattttggcggtatttaatcccatggatttt 21445387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University