View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_61 (Length: 252)
Name: NF5265_low_61
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 89 - 240
Target Start/End: Original strand, 47254463 - 47254614
Alignment:
| Q |
89 |
ttacctccattgtgcgaagatagttggagatatcagatgcataaggctcaaaaatctcttcataatcagattttgcattgattttgctgaaatctggttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254463 |
ttacctccattgtgcgaagatagttggagatatcagatgcataagactcaaaaatctcttcataatcagattttgcattgattttgctgaaatctggttt |
47254562 |
T |
|
| Q |
189 |
atcaaaattgaaaccataaaccaaacggacagcatcagatttctttggccta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254563 |
atcaaaattgaaaccataaaccaaacggacagcatcagatttctttggccta |
47254614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 47254376 - 47254412
Alignment:
| Q |
1 |
ctttttctgaacctgagaaacaatcaaaccaataatt |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47254376 |
ctttttctgaacctgagaaacaatcaaaccaaaaatt |
47254412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 136
Target Start/End: Original strand, 47250060 - 47250107
Alignment:
| Q |
89 |
ttacctccattgtgcgaagatagttggagatatcagatgcataaggct |
136 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
47250060 |
ttacctccattgtgcgaagataatcagagatatcagatacataaggct |
47250107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University