View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_65 (Length: 250)
Name: NF5265_low_65
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 17889394 - 17889153
Alignment:
| Q |
1 |
ttatgaaggacatgatttgtttgtataagtatatacttattgacacaaaaccaattatagggttagaatttctttcagctataccattggcagctaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17889394 |
ttatgaaggacatgatttgtttgtataagtatatacttattgacacaaaaccaattatagggtcagaatttctttcagctataccattggcagctaggat |
17889295 |
T |
|
| Q |
101 |
aattcttgacactaaacatcttatcaaagactatggagaggttcctctgcaagttgagttaggatcaaaagaaaaatgcaatctttattgtacaattttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17889294 |
aattcttgacactaaacatcttatcaaagactatggagaggttcctttgcaagttgagttaggatcaaaagaaaaatgcaatctttattgtacaattttg |
17889195 |
T |
|
| Q |
201 |
ttaaggaatgttaacaatttagggcatgatcatgagtattat |
242 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
17889194 |
ttaaggaatgttaacaatgtaggccataatcatgagtattat |
17889153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University