View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_81 (Length: 229)
Name: NF5265_low_81
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 29631725 - 29631949
Alignment:
| Q |
1 |
tacatgaaaatttaaaatgaaaaatccacaagcaaccagctactcattaatatatattggattttcttctacttatatccgggttttggcaatcagagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29631725 |
tacatgaaaatttaaaatgaaaaatccacaagcaaccagctactcgttaatatatattggatttttttctacttatatccgggttttggcaatcagagta |
29631824 |
T |
 |
| Q |
101 |
acactcattcaccaagtcaaatagaacatagatacaactcgagttgaatcaagcagcatct--acacacacacatgtaaaagaaaaccataaaattatta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631825 |
acactcattcaccaagtcaaatagaacatagatacaactcgagttgaatcaagcaacatctacacacacacacatgtaaaagaaaaccataaaattatta |
29631924 |
T |
 |
| Q |
199 |
ttttctcattgcctcatgatgatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29631925 |
ttttctcattgcctcatgatgatgt |
29631949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University