View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_86 (Length: 223)
Name: NF5265_low_86
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 58 - 195
Target Start/End: Original strand, 26170191 - 26170328
Alignment:
| Q |
58 |
cggcattaccaaaagagcatatatttaaggaaacttaagagctaggagtggagcttttacgtgagaaaatggagttggaaaacacactctaaacatgtta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26170191 |
cggcattaccaaaagagcatatatttaaagaaatttaagagctaggagtggagcttttacgtgagaaaatggagttggaaaacacactctaaacatgtta |
26170290 |
T |
 |
| Q |
158 |
ggtagagagacttcataattagagtgattcaatctttc |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26170291 |
ggtacagagacttcataattagagtgattcaatctttc |
26170328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University