View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_91 (Length: 212)
Name: NF5265_low_91
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 5 - 197
Target Start/End: Complemental strand, 22483812 - 22483620
Alignment:
| Q |
5 |
agtttcaataatactaagacgccacacaattttgtcaaattcgcaatgatttcaaaaatcaattaactctttgttttttacttgtgtacacatatgtatg |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22483812 |
agtttcaataatactacgacgccacacaattttgtcaaattcgcaatgatttcaaaaatcaattaactctttgttttttacttgtgtacacatatgtatg |
22483713 |
T |
 |
| Q |
105 |
tactatgtatggatagatcacaaaaaattgtactatttggttttcttgtccactaaatttgttgtgttgtgttgttgcagcaaatgtctaacc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22483712 |
tactatgtatggatagatcacaaaaaattgtactatttggttttcttgtccactaaatttgttgtgttgtgttgttgcagcaaatgtctaacc |
22483620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University