View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_92 (Length: 211)
Name: NF5265_low_92
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_92 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 5396276 - 5396066
Alignment:
| Q |
1 |
acttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgtttgatatccggtcactcggcatcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5396276 |
acttgaatacataacacgtggcaaacaacggatcaaggccggcttaggaactcgtcgaccgtggaaaaccatgttcgatatccggtcactcggcatcccc |
5396177 |
T |
|
| Q |
101 |
actggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgtttctgagccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396176 |
actggtgtaccggaagcaatttcacgtgttcgtgtcaacatctcatacttccgcatgaactacactatggtgatgcttttgattttgtttctgagccttt |
5396077 |
T |
|
| Q |
201 |
tatggcatcct |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
5396076 |
tatggcatcct |
5396066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University