View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5265_low_95 (Length: 203)
Name: NF5265_low_95
Description: NF5265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5265_low_95 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 38278463 - 38278629
Alignment:
| Q |
19 |
tggatttccattgtatctctgaagcaactgacatcaaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataatgacacatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
38278463 |
tggatttccattgtatctctgaagcaactaacatccaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataataacccatc |
38278562 |
T |
 |
| Q |
119 |
caagtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcaaaatct |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38278563 |
taagtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcgaaatct |
38278629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 182
Target Start/End: Original strand, 38270579 - 38270738
Alignment:
| Q |
22 |
atttccattgtatctctgaagcaactgacatcaaattcataggtggctttgccattccacagccagtaccaccaaaaccgccggataatgacacatccaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| |||||| |||||||||| ||| ||||||| || |||| || |
|
|
| T |
38270579 |
atttccattgtatctctgaagcaactaacatccaattcataggtggcttcgccattccgcagccaccaccaccaaaa-cgcaggataataacgcatctaa |
38270677 |
T |
 |
| Q |
122 |
gtatgcccttgtgtcgttatcgatcactatcactgaaccatatgatcctggtccatcaaaa |
182 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
38270678 |
gtatacccttgcgtcgttatcgatcactatcactaaaccatatgttccaggtccatcaaaa |
38270738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 38274605 - 38274656
Alignment:
| Q |
19 |
tggatttccattgtatctctgaagcaactgacatcaaattcataggtggctt |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
38274605 |
tggatttccattgtatctctgaagtaactaacatccaattcataggtggctt |
38274656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University