View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_high_13 (Length: 321)
Name: NF5268_high_13
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 19 - 152
Target Start/End: Original strand, 16860035 - 16860171
Alignment:
| Q |
19 |
ctaggttgatggaagaggtagagggatttgaggagtgcgtgttaatgcaggtctcggtaaaatgattgaccatctctctttacacattcttca----aca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||| |
|
|
| T |
16860035 |
ctaggttgatggaagaggtagagggatttgaggagtgcgtgttaatgcaggtctcggtaaaatgattgatcatctctcttt--acattcttcaacgtaca |
16860132 |
T |
 |
| Q |
115 |
tcatgcgatttatatctatc-tacttcagatttgagttg |
152 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
16860133 |
tcatgcgatttatatctatcttatttcagatttgagttg |
16860171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 16861786 - 16861848
Alignment:
| Q |
170 |
cattttgcattggaggatttgtactcatccatttgttcatgttattagtattatacaaattgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16861786 |
cattttgcattggaggatttgtactcatccatttgttcatgtcattagtattatacaaattgt |
16861848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University