View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_low_13 (Length: 332)
Name: NF5268_low_13
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 10 - 281
Target Start/End: Original strand, 7243217 - 7243488
Alignment:
| Q |
10 |
ctcaagtggatttttcatatgcaacacaacacttgtgtattattggattggaggatcttttatctccaaagtagttacaagacaaatattttgtttgtta |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7243217 |
ctcaagtggatttctcatatgcaacacaacacttgtgtattattggattggaggatcttttatctccaaagtagttacaagacaaatattttgtttgtta |
7243316 |
T |
 |
| Q |
110 |
accatttccctcttttactcttttagtcactttattgacataaaatatatgttaattttgtcgaagattaatctttatatgagaacttgattgatcatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
7243317 |
accatttccctcttttactcttttagtcactttattgacataaagtatatgttgattttgtcgaagactaatctttacatgagaacttgattgatcatat |
7243416 |
T |
 |
| Q |
210 |
ctagtggaatcttcctttccaaatatattttttcatcgacaaatatgatatattacttaagagatctaaatt |
281 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7243417 |
ttagtggaatcttcctttccaaatacattttttcatcgacaaatatgatatattgcttaagagatctaaatt |
7243488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University