View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_low_21 (Length: 253)
Name: NF5268_low_21
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 31 - 233
Target Start/End: Original strand, 3046998 - 3047200
Alignment:
| Q |
31 |
acttggtttggattagctttttggtctgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatggtgtaatagaggtcattgctgg |
130 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3046998 |
acttggtttggattagctttttggtgtgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatggtgtaatagaggtcattgctgg |
3047097 |
T |
|
| Q |
131 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047098 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
3047197 |
T |
|
| Q |
231 |
atc |
233 |
Q |
| |
|
||| |
|
|
| T |
3047198 |
atc |
3047200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 191
Target Start/End: Original strand, 3046932 - 3047022
Alignment:
| Q |
102 |
ttgtatggtgtaatagaggtcattgctggctgtttttctggtatggacatgcaaatactt-gttctacttagtttggcttagctttttggt |
191 |
Q |
| |
|
|||||| || |||||||||| ||| |||||||||||||||| | |||| ||| | |||| ||| ||||| |||||| ||||||||||||| |
|
|
| T |
3046932 |
ttgtattgtataatagaggttatttgtggctgtttttctggttttgacaagcataaacttggttttacttggtttggattagctttttggt |
3047022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University