View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_low_32 (Length: 233)
Name: NF5268_low_32
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 25 - 227
Target Start/End: Original strand, 43906972 - 43907174
Alignment:
| Q |
25 |
ggaaaattaacagcaaaaattgcttgaagttgattaagacaagattagaaacaataaggaagaagcgaaacgcagtgcaaaaatttcttacgaaagatct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43906972 |
ggaaaattaacagcaaaaattgcttgaagttgataaagacaagattagaaacaataaggaagaagcgaaacgcagtgcaaaaatttcttaagaaagatct |
43907071 |
T |
 |
| Q |
125 |
tgttgatcttctcaagaattctcttgaatacaacgcatatggaagggtaatctttaactttcttgtaaattttgattcattcttaattaatattcttcga |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
43907072 |
tgttgatcttctcaagaattctcttgaatacaatgcatatggaagggtaatctttaactttcttgtaaattttgattcattcttaattaattttctttga |
43907171 |
T |
 |
| Q |
225 |
cat |
227 |
Q |
| |
|
||| |
|
|
| T |
43907172 |
cat |
43907174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University