View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_low_34 (Length: 223)
Name: NF5268_low_34
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 34 - 209
Target Start/End: Complemental strand, 32422747 - 32422571
Alignment:
| Q |
34 |
actcaaatgattagtttgcacagttgcgcgcacgaatgatacctagtttacaccaaaaaatctctctacctgaattctttccannnnnnnn-agattaat |
132 |
Q |
| |
|
|||||||||||||||||||| |||| | |||||| |||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
32422747 |
actcaaatgattagtttgcaaagttacacgcacggatgatatctagtttacaccaaaaaatctctctacctgaattcttcccatttttttttagattaat |
32422648 |
T |
 |
| Q |
133 |
aaaggaaataattacaacattaaacgtatctagtagtattttagtatgcacgtatctggtcgtattttagcatgtat |
209 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32422647 |
aaaggaaatatttacaacattaaacgtatctagtagtattttagtatgcacgtatctggtcgtattttagcatgtat |
32422571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 32422761 - 32422728
Alignment:
| Q |
1 |
ttaagttccataagactcaaatgattagtttgca |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32422761 |
ttaagttccataagactcaaatgattagtttgca |
32422728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University