View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5268_low_36 (Length: 216)

Name: NF5268_low_36
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5268_low_36
NF5268_low_36
[»] chr1 (1 HSPs)
chr1 (14-198)||(10609495-10609687)
[»] chr4 (1 HSPs)
chr4 (15-79)||(14518567-14518632)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 10609687 - 10609495
Alignment:
14 aatatgatatgataaaataatattatcatagttgttttgttgtgcgcatcaacacatgataagataacggtttatcctacctatatcatatcttaattta 113  Q
    |||||||||||||||||||||||||  || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10609687 aatatgatatgataaaataatattagtatggttgttttgttgtgcgcatcaacacatgataagataacggtttatcctacctatatcatatcttaattta 10609588  T
114 tcatgctttgtattttagcatgtctctataagacattgagcaatcttttgtcatatacaa--------gaataattgacaacacaagtaagat 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||        |||||||||||||||||||||||||    
10609587 tcatgctttgtattttagcatgtctctataagacattgagcaatcttttgtcatatgcaatgtttggtgaataattgacaacacaagtaagat 10609495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 14518567 - 14518632
Alignment:
15 atatgatatgataaaataatattatcatagttgttttgttgtgcgcatc-aacacatgataagata 79  Q
    ||||||||||||||||||||||||||||  || || | ||||||||||| ||||||||||| ||||    
14518567 atatgatatgataaaataatattatcatctttcttatcttgtgcgcatcaaacacatgatatgata 14518632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University