View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5268_low_36 (Length: 216)
Name: NF5268_low_36
Description: NF5268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5268_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 10609687 - 10609495
Alignment:
| Q |
14 |
aatatgatatgataaaataatattatcatagttgttttgttgtgcgcatcaacacatgataagataacggtttatcctacctatatcatatcttaattta |
113 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10609687 |
aatatgatatgataaaataatattagtatggttgttttgttgtgcgcatcaacacatgataagataacggtttatcctacctatatcatatcttaattta |
10609588 |
T |
 |
| Q |
114 |
tcatgctttgtattttagcatgtctctataagacattgagcaatcttttgtcatatacaa--------gaataattgacaacacaagtaagat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
10609587 |
tcatgctttgtattttagcatgtctctataagacattgagcaatcttttgtcatatgcaatgtttggtgaataattgacaacacaagtaagat |
10609495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 14518567 - 14518632
Alignment:
| Q |
15 |
atatgatatgataaaataatattatcatagttgttttgttgtgcgcatc-aacacatgataagata |
79 |
Q |
| |
|
|||||||||||||||||||||||||||| || || | ||||||||||| ||||||||||| |||| |
|
|
| T |
14518567 |
atatgatatgataaaataatattatcatctttcttatcttgtgcgcatcaaacacatgatatgata |
14518632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University