View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270-Insertion-5 (Length: 211)
Name: NF5270-Insertion-5
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270-Insertion-5 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 211
Target Start/End: Original strand, 45729173 - 45729245
Alignment:
| Q |
139 |
tgaagagattccttctcgtagtaaattgtctcatattatccctaggtacctgcagtgctcccctcataatgcg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729173 |
tgaagagattccttctcgtagtaaattgtctcatattatccctaggtacctgcagtgctcccctcataatgcg |
45729245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 7 - 73
Target Start/End: Original strand, 45729038 - 45729107
Alignment:
| Q |
7 |
atatagcccctacatatctgagcattaagtttcattat---taagcaattacacaaatcaaagtagtgac |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45729038 |
atatagcccctacatatctgagcattaagtttcattattaataagcaattacacaaatcaaagtagtgac |
45729107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 45724870 - 45724924
Alignment:
| Q |
19 |
catatctgagcattaagtttcattattaagcaattacacaaatcaaagtagtgac |
73 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
45724870 |
catatgtgagcattaagtttcattattaagcaatcacacaaaccaaagtagtgac |
45724924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 45724991 - 45725056
Alignment:
| Q |
146 |
attccttctcgtagtaaattgtctcatattatccctaggtacctgcagtgctcccctcataatgcg |
211 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||||||||| || | ||| |||||| |||||||| |
|
|
| T |
45724991 |
attccttctgatagtaaattgtctgatattagccctaggtaactccggtggtcccctaataatgcg |
45725056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University