View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_29 (Length: 302)
Name: NF5270_high_29
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 4244835 - 4244992
Alignment:
| Q |
17 |
caaaggtgatgaggctaaatattggaagataaacactatgggttttgaatattgatggtgcaacaaactagcatatattatataatgttaatttacgcgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4244835 |
caaaggtgatgaggctaaatattggaagataaacactatgggttttgaatattgatggtgcaacaaactagcatattatatataatgttaatttacgcgc |
4244934 |
T |
 |
| Q |
117 |
taacttataaatgcagtatatattccttaacatgcaagattcaatttcttgatgaggatt |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4244935 |
taacttataaatgcag--tatattccttaacatgcaagattcaatttcttgataaggatt |
4244992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University