View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_32 (Length: 266)
Name: NF5270_high_32
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 36 - 228
Target Start/End: Original strand, 29332197 - 29332390
Alignment:
| Q |
36 |
tttggttcagatttagattaaattcaattgattattcaaatcaatttgaactatttttt-ggtatnnnnnnntcgattcaaactaatttaattagtttgt |
134 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
29332197 |
tttggttcagatttagagtaaattcaattgattattcaaatcaatttgaactatttttttggtataaaaaaatcaattcaaactaatttaattagtttgt |
29332296 |
T |
 |
| Q |
135 |
tttgaattaccataactttatcatgttagtttgcatatcggctatccgtcctttaatgcgaaaacaaaccattacaggccccttcaatggatat |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
29332297 |
tttgaattactataactttatcatgttagtttgcatatctgctatcgatccattaatgcgaaaacaaactattataggccccttcaatgaatat |
29332390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University