View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5270_high_32 (Length: 266)

Name: NF5270_high_32
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5270_high_32
NF5270_high_32
[»] chr6 (1 HSPs)
chr6 (36-228)||(29332197-29332390)


Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 36 - 228
Target Start/End: Original strand, 29332197 - 29332390
Alignment:
36 tttggttcagatttagattaaattcaattgattattcaaatcaatttgaactatttttt-ggtatnnnnnnntcgattcaaactaatttaattagtttgt 134  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||       || |||||||||||||||||||||||||    
29332197 tttggttcagatttagagtaaattcaattgattattcaaatcaatttgaactatttttttggtataaaaaaatcaattcaaactaatttaattagtttgt 29332296  T
135 tttgaattaccataactttatcatgttagtttgcatatcggctatccgtcctttaatgcgaaaacaaaccattacaggccccttcaatggatat 228  Q
    |||||||||| |||||||||||||||||||||||||||| ||||||  ||| ||||||||||||||||| |||| |||||||||||||| ||||    
29332297 tttgaattactataactttatcatgttagtttgcatatctgctatcgatccattaatgcgaaaacaaactattataggccccttcaatgaatat 29332390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University