View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_38 (Length: 251)
Name: NF5270_high_38
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 72 - 244
Target Start/End: Original strand, 14308727 - 14308899
Alignment:
| Q |
72 |
ttcaattaaatcttctatataatttactttgagctcattatcatgagtaatatctcttgaaatgttttaactgtttctaccaatttacatctaagataat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14308727 |
ttcaattaaatcttctatataatttactttgagctcattatcatgagtgatatctcttgaaatgttttaactgtttctaccaatttacatctaagataat |
14308826 |
T |
 |
| Q |
172 |
ctgaattattgttgttgtattagccagcacaaatgtatttgattgatttggtctgttgatagtattcatctca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14308827 |
ctgaattattgttgttgtattagccagcacaaatgtatttgattgatttggtctgttgatagtattcttctca |
14308899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University