View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_44 (Length: 242)
Name: NF5270_high_44
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_44 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 30803881 - 30803823
Alignment:
| Q |
185 |
ttagagctatgttatttcaacccaaaaaa-tatatatcaaatttaaccgttagtataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30803881 |
ttagagctatgttatttcaacccaaaaaaatatatatcaaatttaaccgttagtataat |
30803823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 30804132 - 30804087
Alignment:
| Q |
1 |
tcggaactccgatgagtatatctctgcaattcgcattattctggcg |
46 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
30804132 |
tcggagctccggtgaggatatctctgcaattcgcattattctggcg |
30804087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 166
Target Start/End: Complemental strand, 30804006 - 30803967
Alignment:
| Q |
127 |
acccattcaacattgtactaaatttatagctgttgtcgac |
166 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30804006 |
acccgttcaacattgtactaaatttagagctgttgtcgac |
30803967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University