View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_45 (Length: 240)
Name: NF5270_high_45
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 14308667 - 14308728
Alignment:
| Q |
18 |
caaattggatgcttttgggaaagagacaaattatagaaggattatcctcctgtccaaaaatt |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14308667 |
caaattggatgcttttgggaaagagacaaattatagaaggattatcctcctatccaaaaatt |
14308728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 97
Target Start/End: Complemental strand, 14438224 - 14438152
Alignment:
| Q |
26 |
atgcttttgggaaagagacaaattatagaaggattatcctcctgtccaaaaatttctcaag-atgtaaacttt |
97 |
Q |
| |
|
||||||||| || ||| ||||||||||||| ||||||||| ||||||| ||||||| || ||||||||||| |
|
|
| T |
14438224 |
atgcttttgaaaaggagtcaaattatagaagaattatcctcttgtccaaggatttctccagcatgtaaacttt |
14438152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University