View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_47 (Length: 237)
Name: NF5270_high_47
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 26455127 - 26455329
Alignment:
| Q |
20 |
ctcagttgtatcttcaacaatgccttccttgttctatttcccataattacacttccatacttttgtttgttgtgacttggaacaatggcttcctcagttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26455127 |
ctcagttgtatcttcaacaatgccttacttgttctatttcccataattacacttccatacttttgtttgttgtgacttggaacaatggcttcctcagttg |
26455226 |
T |
 |
| Q |
120 |
catcttcagtttaacttcttggtgagagtcacgaattgggaagccatagggttgtggttgaccataaaagttctataggcatccagctccaaaacttcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26455227 |
catcttcagtttaacttcttggtgagagtcacgaattgggaagccatagggttgtggttgaccataaaagttctataggcatccagctccaaaacttcct |
26455326 |
T |
 |
| Q |
220 |
atg |
222 |
Q |
| |
|
||| |
|
|
| T |
26455327 |
atg |
26455329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University