View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_high_63 (Length: 202)
Name: NF5270_high_63
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_high_63 |
 | |
|
| [»] scaffold0108 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0108 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: scaffold0108
Description:
Target: scaffold0108; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 16332 - 16500
Alignment:
| Q |
19 |
ggacaacattcaatgaaccacaagtgacagctatccacaattacatgcacggctatgataatgacgatcgtgaaccatgccaagacactggaatgtgttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16332 |
ggacaacattcaatgaaccacaagtgacagctatccacaattacatgcacggctatgataatgacgatcgtgaaccatgccaagacactggaatgtgttc |
16431 |
T |
|
| Q |
119 |
agaagcttatacagtccttcataatttccttatttgccatgccacagcagcaaagttataccgaaaaaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16432 |
agaagcttatacagtccttcataatttccttatttgccatgccacagcagcaaagttataccgaaaaaa |
16500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 61 - 179
Target Start/End: Original strand, 12414263 - 12414381
Alignment:
| Q |
61 |
acatgcacggctatgataatgacgatcgtgaaccatgccaagacactggaatgtgttcagaagcttatacagtccttcataatttccttatttgccatgc |
160 |
Q |
| |
|
||||||| ||| ||||||||||| | ||||| ||||||||| || |||| ||||||||||||||||||| ||||||| || | |||||||||||||| |
|
|
| T |
12414263 |
acatgcatggcattgataatgacgctgctgaacgatgccaagatacaggaaagtgttcagaagcttatacaatccttcacaactatcttatttgccatgc |
12414362 |
T |
|
| Q |
161 |
cacagcagcaaagttatac |
179 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
12414363 |
tgcagcagtaaagttatac |
12414381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University