View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_15 (Length: 413)
Name: NF5270_low_15
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 11 - 398
Target Start/End: Complemental strand, 39092181 - 39091793
Alignment:
| Q |
11 |
atactatgagcatccataacgggagtatatggggtggatgtggctaattatctttacagtatgttaatccttcattaccttcaattgtcatttggtagta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39092181 |
atactatgagcatccataacgggagtatatggagtggatgtggctaattatctttacagtatgttgatccttcattaccttcaattgtcatttggtagta |
39092082 |
T |
|
| Q |
111 |
ctcatggctaactttacaagaagggat-tggcttggatcatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataaggctc |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092081 |
ctcatggctaactttacaagaagggtcctggcttggaccatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataaggctc |
39091982 |
T |
|
| Q |
210 |
attaaaattttgtagagtaagctaacaagaatatatttatatttatcatatcacataagtttcattttctagcaagtttctaatatcaaataaaaatcta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39091981 |
attaaaattttgtagagtaagctaacaagaatatatttatatttatcatatcacataagtttcattttctagcaagtttctaatatcaaataaaaatcta |
39091882 |
T |
|
| Q |
310 |
agcacaatatgaagatccacatacttttcattgcaaggtgtaaacaagaaacaaacaagaggttctgagaaccgaggacaactactact |
398 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39091881 |
agcacaatatgaagatccacatgcttttcattgcaaggtgtaaacaagaaacaaacaagaggttctgagaaccgaggacaactactact |
39091793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University