View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_17 (Length: 379)
Name: NF5270_low_17
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 19 - 364
Target Start/End: Original strand, 35805574 - 35805919
Alignment:
| Q |
19 |
aatactaatatggatcgattccctttgcagatagttagatcaaaaccctaaatgatgaaattgagggtggaagccaagggtccacggtggcagtggtggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805574 |
aatactaatatggatcgattccctttgcagatagttagatcaaaaccctaaatgatgaaattgagggtggaagccaagggtccacggtggcagtggtggg |
35805673 |
T |
|
| Q |
119 |
ggaattatgtaagcaccggtggtggtgaatagtacatatatctcatgagacatttgaaagcaaccctcatggctaccttgagtggtcttcatgttgtgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805674 |
ggaattatgtaagcaccggtggtggtgaatcgtacatatatctcatgagacatttgaaagcaaccctcatggctaccttgagtggtcttcatgttgtgga |
35805773 |
T |
|
| Q |
219 |
caaggccagcaagtggtgttgtttaacttcaattctaactagcctcttaatttacaaactagcctcttaatttacattaataaattcatatgcaattgcg |
318 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805774 |
caaggccaacaagtggtgttgtttcacttcaattctaactagcctcttaatttacaaactagcctcttaatttacattaataaattcatatgcaattgcg |
35805873 |
T |
|
| Q |
319 |
tggtggagatttatatttatcacaattttgatggtggtggtgtgat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35805874 |
tggtggagatttatatttatcacaattttgatggtggtggtatgat |
35805919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University