View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_33 (Length: 265)
Name: NF5270_low_33
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 52876960 - 52877082
Alignment:
| Q |
1 |
atctatttgattttatttgacataattcacttgaaatacgactttattctttacagggtatatgtttaatgataacagtgttgcaattagctcgcttgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52876960 |
atctatttgattttatttgacataattcacttgaaatacgattttattctttacagggtatatgtttaatgataacagtgttgcaattagctcgtttgcc |
52877059 |
T |
|
| Q |
101 |
taatattaaggtagatgattgac |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52877060 |
taatattaaggtagatgattgac |
52877082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 193 - 265
Target Start/End: Original strand, 52877159 - 52877231
Alignment:
| Q |
193 |
atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttgttgcgcatttgtatatgatatctt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52877159 |
atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttgttgcgcatttgtatatgacatctt |
52877231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University