View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_42 (Length: 247)
Name: NF5270_low_42
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 5400248 - 5400476
Alignment:
| Q |
1 |
atttacatgtggtcattggacaattactagtgtgttgtttgtttctttcatgttctaaaaaagatatgaaaatgtttttggatttttatgattttcatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5400248 |
atttacatgtggtcattggacaattactagtgtgttgtttgtttctttcattttctaaaaaagatatgaaaatgtttttggatttttatgattttcatta |
5400347 |
T |
|
| Q |
101 |
tccatgccatcatgattgacatacaatgtaagtaaagtttattgtcctctcataatcgtggcagttttgatcgcataattgctactgatgagtaattctc |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5400348 |
tccatgccatcatgattgatataaaatgtaagtaaaatttattgtcctctcataatcgtggcagttttgatcgcataattgctactgatgagtaattctc |
5400447 |
T |
|
| Q |
201 |
taaaacatggaatctaagaacaaatattt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5400448 |
taaaacatggaatctaagaacaaatattt |
5400476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University