View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5270_low_45 (Length: 240)

Name: NF5270_low_45
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5270_low_45
NF5270_low_45
[»] chr5 (1 HSPs)
chr5 (18-79)||(14308667-14308728)
[»] chr6 (1 HSPs)
chr6 (26-97)||(14438152-14438224)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 14308667 - 14308728
Alignment:
18 caaattggatgcttttgggaaagagacaaattatagaaggattatcctcctgtccaaaaatt 79  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
14308667 caaattggatgcttttgggaaagagacaaattatagaaggattatcctcctatccaaaaatt 14308728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 97
Target Start/End: Complemental strand, 14438224 - 14438152
Alignment:
26 atgcttttgggaaagagacaaattatagaaggattatcctcctgtccaaaaatttctcaag-atgtaaacttt 97  Q
    |||||||||  || ||| ||||||||||||| ||||||||| |||||||  ||||||| || |||||||||||    
14438224 atgcttttgaaaaggagtcaaattatagaagaattatcctcttgtccaaggatttctccagcatgtaaacttt 14438152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University