View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_51 (Length: 234)
Name: NF5270_low_51
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 25933296 - 25933090
Alignment:
| Q |
1 |
catatcttccatttgattcacgtggtgtccgtcgctttctaggaaattcaatttgaactggattttgtgttcatttgatgggagaaagaaaaaataaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25933296 |
catatcttccatttgattcacgtggtgtccatcactttctaggaaattcaatttgaactgggttttgtgttcatttgatgggagaaagaaaaaattaaac |
25933197 |
T |
 |
| Q |
101 |
agggattcatannnnnnnnnataggtttaaggaattatagcttttgttgttttgggttcatgaatttctagtgattagatcagttgttgttgatggtggt |
200 |
Q |
| |
|
| |||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||| || |
|
|
| T |
25933196 |
atggattcat---cttttttataggtttaaggaattagagcttttgttgttatgggttcatgaatttctggtgattagataagttgttgttgatggtagt |
25933100 |
T |
 |
| Q |
201 |
gggggtgtag |
210 |
Q |
| |
|
|| ||||||| |
|
|
| T |
25933099 |
ggaggtgtag |
25933090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University