View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_54 (Length: 228)
Name: NF5270_low_54
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_54 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 9137188 - 9137415
Alignment:
| Q |
1 |
gcatctgatcttccgtgcaatttgggaatctaatctttctaacatcagatgcggagttagatatggtgggctgatggcggcgttcatccaatgacctgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9137188 |
gcatctgatcttccgtgcaatttgggaatctaatctttcttacatcagatgcggagttagatatggtgggctgatggcggtgttcatccaatgacctgcg |
9137287 |
T |
 |
| Q |
101 |
agaccattgcctacatcgttttggctttctggtcaagacaaaacttggagaaaattttacaagaatatcctttggttgttgatcgagaagaaatttcttt |
200 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9137288 |
agaccattgcccacatcgttatggctttctggtcaagacaaaacttggagaaaattttacaagaatatcctttggttgttgatcgagaagaaacttcttt |
9137387 |
T |
 |
| Q |
201 |
aacaagccaaataagagaatctatattc |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
9137388 |
aacaagccaaatgagagaatctatattc |
9137415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 163
Target Start/End: Original strand, 31402613 - 31402756
Alignment:
| Q |
19 |
aatttgggaatctaatctttctaacatcagatgcggagttagatatggtgggctgatggcggcgttcatccaatgacctgcgagaccattgcctacatcg |
118 |
Q |
| |
|
||||||||||| | |||||||| ||| || ||| |||||||||| || ||||||||||| || || ||||||||||| || ||| ||| | || ||||| |
|
|
| T |
31402613 |
aatttgggaatatgatctttcttacaccatatgtggagttagat-tgttgggctgatggtggagtacatccaatgacatgtgaggccactagctccatcg |
31402711 |
T |
 |
| Q |
119 |
ttttggctttctggtcaagacaaaacttggagaaaattttacaag |
163 |
Q |
| |
|
| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
31402712 |
tcgcggctttttggtcaagacaaaatctggagaaaattttacaag |
31402756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 153
Target Start/End: Original strand, 31459124 - 31459205
Alignment:
| Q |
72 |
tgatggcggcgttcatccaatgacctgcgagaccattgcctacatcgttttggctttctggtcaagacaaaacttggagaaa |
153 |
Q |
| |
|
|||||| || ||||||||||| || ||||| ||||||| |||||| | ||||||| ||||||||||||||| | |||||| |
|
|
| T |
31459124 |
tgatggtggggttcatccaattacttgcgataccattgattacatcactatggctttttggtcaagacaaaacctagagaaa |
31459205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 117
Target Start/End: Original strand, 31386655 - 31386699
Alignment:
| Q |
73 |
gatggcggcgttcatccaatgacctgcgagaccattgcctacatc |
117 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
31386655 |
gatggtggggttcatccaatgacttgcgagaccattgactacatc |
31386699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University